| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.199361 |
| Chromosome: | chromosome 10 |
| Location: | 3991602 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g448850 | FAP135,ODA5AK,CAL5 | (1 of 3) 3.4.22.54 - Calpain-3 / Muscle-specific calcium-activated neutral protease 3; Calpain-Like Flagellar Associated Protein 135 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTGCCTGCCTACCAAAGCCTGGCCTGGA |
| Internal bar code: | CAACGGCGCCGGTGTCAAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 880 |
| LEAP-Seq percent confirming: | 98.771 |
| LEAP-Seq n confirming: | 6349 |
| LEAP-Seq n nonconfirming: | 79 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACTGATCACAGGCGTCTC |
| Suggested primer 2: | ACGTTGCCTCTTGGAGAGAA |