| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.199432 |
| Chromosome: | chromosome 3 |
| Location: | 7184793 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g208100 | RNB1,Rrp44 | 3'-5' exoribonuclease II; (1 of 1) K18758 - DIS3-like exonuclease 2 [EC:3.1.13.-] (DIS3L2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGGCAAAGTCCTGTTAGCTTATGGTGTT |
| Internal bar code: | GTAAAGCACGGTAGTCAAGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 904 |
| LEAP-Seq percent confirming: | 99.6458 |
| LEAP-Seq n confirming: | 844 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTGAAATGACTCGGCCAC |
| Suggested primer 2: | GACGCTAGTCCCAGCAGTTC |