| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.199437 |
| Chromosome: | chromosome 8 |
| Location: | 244054 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358553 | (1 of 1) IPR000104//IPR001810//IPR006553 - Antifreeze protein, type I // F-box domain // Leucine-rich repeat, cysteine-containing subtype | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGGGGCCTGGTGGTGGTGGTGGTGGTG |
| Internal bar code: | TAAACCTTCTTTCCCGATGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 319 |
| LEAP-Seq percent confirming: | 86.7784 |
| LEAP-Seq n confirming: | 466 |
| LEAP-Seq n nonconfirming: | 71 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGATACGCCCCAGTAACTA |
| Suggested primer 2: | TGTTACGCCGTACGTGTCAT |