| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.199483 |
| Chromosome: | chromosome 12 |
| Location: | 2379691 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g507400 | LCS3,CGL105 | (1 of 4) K01897 - long-chain acyl-CoA synthetase (ACSL, fadD); Long-chain acyl-CoA synthetase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGCTAGCGTGCTGGTGCCCCGCTGTCGG |
| Internal bar code: | CCCGGACTATCCAATCCGCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 489 |
| LEAP-Seq percent confirming: | 99.7575 |
| LEAP-Seq n confirming: | 2880 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACCCTTCCCTCGTTCCTC |
| Suggested primer 2: | CCTGCATTCTTCGTCTCCTC |