Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.199640 |
Chromosome: | chromosome 10 |
Location: | 1287395 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g427300 | PF24,RSP2 | Radial Spoke Protein 2; (1 of 1) PTHR23356//PTHR23356:SF5 - DPY30-RELATED // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACCGAACATCGAACTTGTCGCCCAGACC |
Internal bar code: | GGGGGGGAGGGTCCACCGAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 560 |
LEAP-Seq percent confirming: | 99.5546 |
LEAP-Seq n confirming: | 894 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAACTTGACTTGGTGGGTGC |
Suggested primer 2: | CGCTAGAGGACAGGAAGTGG |