Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.199664 |
Chromosome: | chromosome 2 |
Location: | 248181 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g074800 | CYG9 | (1 of 1) IPR000700//IPR001054//IPR029787 - PAS-associated, C-terminal // Adenylyl cyclase class-3/4/guanylyl cyclase // Nucleotide cyclase; Adenylate/guanylate cyclase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTGTCTGTGCCTGCCACGACACCCACT |
Internal bar code: | ATGGGGGACGGTTTCTCGCTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 836 |
LEAP-Seq percent confirming: | 99.2064 |
LEAP-Seq n confirming: | 3750 |
LEAP-Seq n nonconfirming: | 30 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTAAGATGCACCGGACCTA |
Suggested primer 2: | CAAGGGCTGTGATGAAGGAT |