| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.199677 |
| Chromosome: | chromosome 13 |
| Location: | 110880 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g562750 | CGLD38 | Conserved in the Green Lineage and Diatoms; (1 of 1) PF14234 - Domain of unknown function (DUF4336) (DUF4336) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGGGTGATGGGGGATGGTGCTTTAGGC |
| Internal bar code: | ACGGCCATCTGCTGTGTCCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 376 |
| LEAP-Seq percent confirming: | 99.6629 |
| LEAP-Seq n confirming: | 2661 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTTGTGGAGTGGGTTGAG |
| Suggested primer 2: | CGTCCGTGGTGATGTAGTTG |