| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.199701 |
| Chromosome: | chromosome 4 |
| Location: | 2542164 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g222300 | SRS3 | (1 of 1) PTHR12323//PTHR12323:SF0 - SR-RELATED CTD ASSOCIATED FACTOR 6 // CALCIUM HOMEOSTASIS ENDOPLASMIC RETICULUM PROTEIN; putative RNA-binding protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTATCGTGGTAGGAGCCGCTGCGCACCT |
| Internal bar code: | CGAAACACCAAGGCTGGCTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 204 |
| LEAP-Seq percent confirming: | 98.8571 |
| LEAP-Seq n confirming: | 173 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTACGTGCACACCGTCTTC |
| Suggested primer 2: | CAACTTATCGACCAGCCCAT |