| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.199764 |
| Chromosome: | chromosome 3 |
| Location: | 5405947 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g184850 | TPT8,TPT9 | (1 of 2) PTHR11132:SF126 - PROTEIN C29A12.6, ISOFORM B; Putative UDP-galactose transporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGTACAGCCACGGCCGCATGATGGCGGG |
| Internal bar code: | TGTTGTTGAACGGACCGACAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 549 |
| LEAP-Seq percent confirming: | 96.7315 |
| LEAP-Seq n confirming: | 1243 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGTGCCTCTTGTCATCA |
| Suggested primer 2: | ACATCCACGCTTGCATAACA |