Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.199801 |
Chromosome: | chromosome 10 |
Location: | 3860829 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g447550 | (1 of 2) PF03200 - Glycosyl hydrolase family 63 C-terminal domain (Glyco_hydro_63) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGGGGTGACCCTTTCGCCATTCTCATTA |
Internal bar code: | TTAGAGTGACTGAAAAAGGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 4.22535 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 340 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCTGATCAATCACACCGCA |
Suggested primer 2: | GACAGGACAGGACACAGGGT |