| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.199885 |
| Chromosome: | chromosome 14 |
| Location: | 2016470 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g621650 | MCT1 | Malonyl-CoA:acyl-carrier-protein transacylase; (1 of 2) K00645 - [acyl-carrier-protein] S-malonyltransferase [EC:2.3.1.39] (fabD) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTGCCCCAAGCCTTTTGACGGTGAAGG |
| Internal bar code: | TCGACAGCCACAAGAGTGGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 944 |
| LEAP-Seq percent confirming: | 94.0695 |
| LEAP-Seq n confirming: | 920 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAATAGGCCGGAATTAAGCC |
| Suggested primer 2: | GGAGCCCCAAAACATCACTA |