| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.199901 |
| Chromosome: | chromosome 16 |
| Location: | 3502525 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g675602 | (1 of 1) K12669 - oligosaccharyltransferase complex subunit gamma (OST3, OST6) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTATGTACCAAACGTGAGTTTGGGACTGC |
| Internal bar code: | CAGTTGGCTGGTCAGGACCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 252 |
| LEAP-Seq percent confirming: | 98.4908 |
| LEAP-Seq n confirming: | 1501 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCCGTGAGTCCCAAAGTG |
| Suggested primer 2: | AGGCCTATGGCTCTGCTACA |