| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.199918 |
| Chromosome: | chromosome 17 |
| Location: | 1762215 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g709050 | HTR3,HTR28 | Histone H3; (1 of 35) K11253 - histone H3 (H3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGAGGGTGACGTGCTGCTGGTAGGCAGA |
| Internal bar code: | CCTAGCCCAAATGGGGTGCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 762 |
| LEAP-Seq percent confirming: | 98.2316 |
| LEAP-Seq n confirming: | 4166 |
| LEAP-Seq n nonconfirming: | 75 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAATTTGTTGTTGAGGCCGT |
| Suggested primer 2: | ACACAAGGCTATGGTCAGGG |