| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.200029 |
| Chromosome: | chromosome 2 |
| Location: | 5394935 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g107350 | DHC4 | (1 of 3) IPR003593//IPR004273//IPR011704//IPR013602//IPR024317//IPR024743//IPR026983//IPR027417 - AAA+ ATPase domain // Dynein heavy chain domain // ATPase, dynein-related, AAA domain // Dynein heavy chain, domain-2 // Dynein heavy chain, P-loop containing D4 domain // Dynein heavy chain, coiled coil stalk // Dynein heavy chain // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGCACGCCGTTTTCAGCGCCGCCGCGA |
| Internal bar code: | GTGACCGAGGGTGCACATCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 898 |
| LEAP-Seq percent confirming: | 99.8003 |
| LEAP-Seq n confirming: | 1999 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCTGGCCGTAGAGCTGAC |
| Suggested primer 2: | CAACGCATTGCAAATGTACC |