| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.200064 |
| Chromosome: | chromosome 2 |
| Location: | 509325 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g076950 | SUB4 | (1 of 1) 3.4.21.62//3.4.24.3 - Subtilisin // Microbial collagenase / Collagenase I; Subtilisin-like protease | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCTTTAAAGTGGCAGGAGAGCGTGTTTT |
| Internal bar code: | TCGCTACCAAGCCCGGCAGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 669 |
| LEAP-Seq percent confirming: | 99.4126 |
| LEAP-Seq n confirming: | 4908 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGCAGAGTCTGGTGTTGA |
| Suggested primer 2: | CATGAACGGTTTTGACATCG |