| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.200068 |
| Chromosome: | chromosome 1 |
| Location: | 5285907 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g036950 | CBA1 | (1 of 1) 2.7.8.26 - Adenosylcobinamide-GDP ribazoletransferase / Cobalamin-5'-phosphate synthase; Cobalamin 5'-phosphate synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGACCCCGCTCCGGAACGACCGGCCGATC |
| Internal bar code: | TACGCAGCGTTCCGCCGGCAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1010 |
| LEAP-Seq percent confirming: | 99.4444 |
| LEAP-Seq n confirming: | 537 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATTTGTATAGGTGGCGCGT |
| Suggested primer 2: | GATGGGGCGCTCATAGATAA |