Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.200100 |
Chromosome: | chromosome 15 |
Location: | 1294689 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g641750 | (1 of 3) PF05495 - CHY zinc finger (zf-CHY) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCCCCGAGGAACACACTGCACCCAGCCC |
Internal bar code: | TGGATGGCCGCGCACACTGGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1043 |
LEAP-Seq percent confirming: | 99.8264 |
LEAP-Seq n confirming: | 6900 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTCACATGAGGTGTTTTG |
Suggested primer 2: | CATTGGAGTAAGTGCCGGTT |