Insertion junction: LMJ.RY0402.200123_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.200123
Chromosome:chromosome_11
Location:328866
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre11.g467567 UBQ1 Ubiquitin sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GAGGACGGCCGTACCCTGGCTGACTACAAC
Internal bar code:ACAGCGCTCAACCGCTCTGAGG

Confirmation - LEAP-Seq

LEAP-Seq distance:2335
LEAP-Seq percent confirming:94.9944
LEAP-Seq n confirming:1708
LEAP-Seq n nonconfirming:90
LEAP-Seq n unique pos:9

Suggested primers for confirmation by PCR

Suggested primer 1:AGATCCAGGACAAGGAGGGT
Suggested primer 2:GCCTTCACGTTCTCAATGGT