| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.200125 |
| Chromosome: | chromosome 13 |
| Location: | 1126003 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g569450 | (1 of 1) IPR000104//IPR029058 - Antifreeze protein, type I // Alpha/Beta hydrolase fold | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCAAACAAGTGCTTCATGCCCTGCTAGA |
| Internal bar code: | CAGCCTAGCCGCTCGTGCTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1004 |
| LEAP-Seq percent confirming: | 99.7567 |
| LEAP-Seq n confirming: | 2050 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATATCGGAACGCACACAACA |
| Suggested primer 2: | ATTTGGTACTTGGGTTTGCG |