| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.200127 |
| Chromosome: | chromosome 15 |
| Location: | 278816 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g640901 | (1 of 1) IPR000104//IPR029033 - Antifreeze protein, type I // Histidine phosphatase superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGACAAGTGTTCCCCGGTCACGGGAAGA |
| Internal bar code: | GCACTAGATGTACGCCCCAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 242 |
| LEAP-Seq percent confirming: | 31.5736 |
| LEAP-Seq n confirming: | 616 |
| LEAP-Seq n nonconfirming: | 1335 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAATCGTGTTTAGGGCGAC |
| Suggested primer 2: | GCCCTGAAGGTACAATCCAA |