Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.200145 |
Chromosome: | chromosome 5 |
Location: | 401968 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g232900 | (1 of 4) PF02181 - Formin Homology 2 Domain (FH2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTTTTCACGCGGGTAGGAGGAAGGACA |
Internal bar code: | ACCAGAAAGTTAGGGGGCTGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 251 |
LEAP-Seq percent confirming: | 69.9043 |
LEAP-Seq n confirming: | 4455 |
LEAP-Seq n nonconfirming: | 1918 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGGGGAGGAGGAAGTTTG |
Suggested primer 2: | CACATTCAATTGGGGTTTCC |