| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.200304 |
| Chromosome: | chromosome 10 |
| Location: | 1619314 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g429601 | (1 of 2) PTHR10060:SF22 - CELL DEATH-RELATED NUCLEASE 2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCGCTTCAGAGCCCAGCTGTGTCAGTC |
| Internal bar code: | AGCCCTAGGGTGAGGAACTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 773 |
| LEAP-Seq percent confirming: | 94.9495 |
| LEAP-Seq n confirming: | 376 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAAGCACAACACCCTTCCG |
| Suggested primer 2: | CAAGACAGCCAATTTCAGCA |