| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.200357 |
| Chromosome: | chromosome 6 |
| Location: | 7577792 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g300933 | (1 of 2) PF15919 - HicB_like antitoxin of bacterial toxin-antitoxin system (HicB_lk_antitox) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCTGTGCCTCGATCCTTTCGCCCCACAG |
| Internal bar code: | GCAGCAACGTTACAATGACGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 828 |
| LEAP-Seq percent confirming: | 99.5362 |
| LEAP-Seq n confirming: | 1717 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCCACTGGTTTAGGTGATT |
| Suggested primer 2: | TACAATTGAAGGGACAGCCC |