| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.200360 |
| Chromosome: | chromosome 1 |
| Location: | 4345467 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g029400 | (1 of 6) PTHR31942//PTHR31942:SF1 - FAMILY NOT NAMED // MLO-LIKE PROTEIN 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGCTCCAGGAACTGCAGCAGCAGGAAG |
| Internal bar code: | CAGCGCCCCGTCGCCGGGGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 304 |
| LEAP-Seq percent confirming: | 69.2334 |
| LEAP-Seq n confirming: | 2050 |
| LEAP-Seq n nonconfirming: | 911 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAGTCCAGCTTGAAGAAC |
| Suggested primer 2: | ACACACACACACACACACGC |