Insertion junction: LMJ.RY0402.200422_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.200422
Chromosome:chromosome_12
Location:222111
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre12.g485000 FAP182 Flagellar Associated Protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CCTGTATGAACGCTTGTTGCCACAGTGTCC
Internal bar code:TCATTACTGCGCGCAACCGTGC

Confirmation - LEAP-Seq

LEAP-Seq distance:246
LEAP-Seq percent confirming:98.452
LEAP-Seq n confirming:318
LEAP-Seq n nonconfirming:5
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:TGTAGGTGAGCGTGTCCTTG
Suggested primer 2:AACCGCGTAGATATGGTTGC