| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.200499 |
| Chromosome: | chromosome 11 |
| Location: | 1551884 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467755 | SNE17 | (1 of 10) PF13460 - NAD(P)H-binding (NAD_binding_10); Extended short-chain dehydrogenase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGTCCTGAACCCTGAGCTCACATGCCGT |
| Internal bar code: | CCCGTCGTAACATCGCACGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 320 |
| LEAP-Seq percent confirming: | 50.4216 |
| LEAP-Seq n confirming: | 299 |
| LEAP-Seq n nonconfirming: | 294 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGCTCAACTTCGCTTCTT |
| Suggested primer 2: | TAACAAGCGCTCTCACCCTT |