| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.200626 |
| Chromosome: | chromosome 10 |
| Location: | 2742531 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g438500 | CPK3,MOT54,FAP264 | (1 of 31) IPR003590 - Leucine-rich repeat, ribonuclease inhibitor subtype; Flagellar Associated Protein 264 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGAATGCACAGAATGCTTGTCCTGCCAA |
| Internal bar code: | ATTGGGCCAACGGATTACCACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1056 |
| LEAP-Seq percent confirming: | 99.59 |
| LEAP-Seq n confirming: | 3158 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAATTATGGCCGTCGTGCT |
| Suggested primer 2: | GCAAGGAATAGCGCAAGAAC |