Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.200648 |
Chromosome: | chromosome 7 |
Location: | 4408078 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g340950 | AXL4 | (1 of 6) PTHR10994//PTHR10994:SF61 - RETICULON // RETICULON-LIKE PROTEIN; Arabinose chain extension enzyme like protein 4 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGAAGCTGGAAGCGGGGGCTCGAGGATT |
Internal bar code: | GCCATATCCCCAACGCTACACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 737 |
LEAP-Seq percent confirming: | 99.6983 |
LEAP-Seq n confirming: | 5617 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCATGTACTCAGGATCGGT |
Suggested primer 2: | CTGTCTCTGCGTCCTCATCA |