| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.200653 |
| Chromosome: | chromosome 6 |
| Location: | 2381177 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g267750 | (1 of 1) PF00050//PF00089 - Kazal-type serine protease inhibitor domain (Kazal_1) // Trypsin (Trypsin) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGTTGAAGACGCAGTGTGCCGCCGTGAG |
| Internal bar code: | GTCGGAAGCCACTGCTTGTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 761 |
| LEAP-Seq percent confirming: | 97.0421 |
| LEAP-Seq n confirming: | 3412 |
| LEAP-Seq n nonconfirming: | 104 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTAAACAAAAGGCAGCAGG |
| Suggested primer 2: | GGAAGAAGCAGACGCAGAAG |