| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.200753 |
| Chromosome: | chromosome 3 |
| Location: | 5420574 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g185000 | GTR8,BGS2,CALS2 | Callose synthase 2; (1 of 2) K11000 - callose synthase [EC:2.4.1.-] Glc b1-3 Glc (CALS) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCGCTGCCTGCACCTGTACCACTCGCT |
| Internal bar code: | TTGGCGGCTCATACACCGAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 30 |
| LEAP-Seq percent confirming: | 5.88235 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 1744 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCAAAATGAGGAACCTGC |
| Suggested primer 2: | GGTTGAGGAAGGAGGAGGAC |