| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.200759 |
| Chromosome: | chromosome 3 |
| Location: | 8118398 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g200800 | CYG61 | (1 of 11) 4.6.1.1//4.6.1.2 - Adenylate cyclase / ATP pyrophosphate-lyase // Guanylate cyclase / Guanylyl cyclase; Adenylate/guanylate cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAACCAAACGCGCGACCCACACATACTT |
| Internal bar code: | CACAGCATCCGTTGTCCGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4 |
| LEAP-Seq percent confirming: | 99.809 |
| LEAP-Seq n confirming: | 2613 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAGGCAGGGCCTATCTAA |
| Suggested primer 2: | TGGCGTCATACTTGCAGAAG |