| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.200797 |
| Chromosome: | chromosome 12 |
| Location: | 4409239 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g520900 | (1 of 88) IPR011333 - POZ domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAAATCAGCGAGTCGCGAAACACAAAGCA |
| Internal bar code: | GGTAGCGTTATAGCGGGAGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 738 |
| LEAP-Seq percent confirming: | 99.8022 |
| LEAP-Seq n confirming: | 1009 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGGGGTTGCTAGTTGTTTA |
| Suggested primer 2: | GTATACACTGCCCTTGCCGT |