| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.200822 |
| Chromosome: | chromosome 15 |
| Location: | 270342 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g640900 | (1 of 17) IPR029069 - HotDog domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAAACCACCGCGTCACGGTATGTTCGCTC |
| Internal bar code: | AAGCAGGTATACAGCCGACGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 862 |
| LEAP-Seq percent confirming: | 91.4602 |
| LEAP-Seq n confirming: | 1735 |
| LEAP-Seq n nonconfirming: | 162 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGTGGACAGAATACCGCC |
| Suggested primer 2: | ATGAGCTGTCAGTGCAGGTG |