| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.200886 |
| Chromosome: | chromosome 12 |
| Location: | 1308373 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g488850 | AP2A1 | Alpha2-Adaptin; (1 of 1) K11824 - AP-2 complex subunit alpha (AP2A) | 3'UTR |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | ATTCAGGTCCGAACCGGTGTAAGGGCACGG |
| Internal bar code: | CGGCATCAGAAGTAAGGCTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 333 |
| LEAP-Seq percent confirming: | 99.7234 |
| LEAP-Seq n confirming: | 721 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCGTTTAGAGGTAAGGCG |
| Suggested primer 2: | TCCCACGCAAACATATCGTA |