| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.200946 |
| Chromosome: | chromosome 6 |
| Location: | 2106016 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g265150 | (1 of 1) K11833 - ubiquitin carboxyl-terminal hydrolase 2/21 [EC:3.4.19.12] (USP2_21) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGACCGGCATCAAAAGACTCCGGGCGGAC |
| Internal bar code: | TTTCACGTAGAGGCACCGCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 956 |
| LEAP-Seq percent confirming: | 99.7989 |
| LEAP-Seq n confirming: | 1489 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTATTTCATCGGGGTGGATG |
| Suggested primer 2: | GCTTCCTAGCATAACAGGCG |