| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.201130 |
| Chromosome: | chromosome 16 |
| Location: | 3609124 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683793 | (1 of 1) K14843 - pescadillo (PES1, NOP7) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAATGCAACCCGCCACACGCAGGCAGGG |
| Internal bar code: | GATTAAGGAAAATCAGTTTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 181 |
| LEAP-Seq percent confirming: | 93.0233 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTTCAGAGTCCAGCCGTC |
| Suggested primer 2: | TGGCAGATAAAACTACCGCC |