Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.201178 |
Chromosome: | chromosome 13 |
Location: | 1265771 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g570700 | CHI7,CHI4 | (1 of 1) IPR001002//IPR001223//IPR011583//IPR017853//IPR029070 - Chitin-binding, type 1 // Glycoside hydrolase family 18, catalytic domain // Chitinase II // Glycoside hydrolase superfamily // Chitinase insertion domain; Chitinase-like hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAGAACGCCCAGCGCCGCTTCTTGGCAC |
Internal bar code: | TTGAGTATTGCGTGCAGCCCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 432 |
LEAP-Seq percent confirming: | 96.0784 |
LEAP-Seq n confirming: | 98 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGCAGAACTGGTCCTCAG |
Suggested primer 2: | CGGTAGTCCCGACATGAGTT |