| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.201178 |
| Chromosome: | chromosome 13 |
| Location: | 1265773 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g570700 | CHI7,CHI4 | (1 of 1) IPR001002//IPR001223//IPR011583//IPR017853//IPR029070 - Chitin-binding, type 1 // Glycoside hydrolase family 18, catalytic domain // Chitinase II // Glycoside hydrolase superfamily // Chitinase insertion domain; Chitinase-like hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCGCAACTCCCGGCATCGGCCTTCGCCC |
| Internal bar code: | TCGGTTCGCGGGATAATGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 601 |
| LEAP-Seq percent confirming: | 98.1284 |
| LEAP-Seq n confirming: | 4509 |
| LEAP-Seq n nonconfirming: | 86 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGCAGAACTGGTCCTCAG |
| Suggested primer 2: | CGGTAGTCCCGACATGAGTT |