Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.201192 |
Chromosome: | chromosome 14 |
Location: | 1126078 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g615350 | THB2 | Truncated hemoglobin; (1 of 2) IPR016339 - Truncated hemoglobin, group 1 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGAGCAAAAGGCGCTGCGAAGAGACCA |
Internal bar code: | AGCGGGGCTCGGCCTGCCGGGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 961 |
LEAP-Seq percent confirming: | 98.0168 |
LEAP-Seq n confirming: | 1285 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGGTCATGAACGCTTGCTG |
Suggested primer 2: | CTGAATCATGTTTTGTGCGG |