| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.201209 |
| Chromosome: | chromosome 2 |
| Location: | 7457402 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g144250 | CYP769A1,CYP13 | (1 of 1) 1.14.13.30 - Leukotriene-B(4) 20-monooxygenase / LTB(4) omega-hydroxylase; Cytochrome P450, CYP4 superfamily | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTCGAGCCAGCCAATACCCACAGCCTTG |
| Internal bar code: | GATGGCTAGTGGCGCCTGTACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 59.2814 |
| LEAP-Seq n confirming: | 198 |
| LEAP-Seq n nonconfirming: | 136 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGGAGGAGGACAGGGA |
| Suggested primer 2: | GGTGTTAATACGCGGCACTT |