Insertion junction: LMJ.RY0402.201275_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.201275
Chromosome:chromosome_10
Location:1655252
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre10.g429750 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TCTATGGCACTTGATTGGTTTTACGTTCCT
Internal bar code:CAACTCCGCCGGAACAAAACTA

Confirmation - LEAP-Seq

LEAP-Seq distance:571
LEAP-Seq percent confirming:99.8646
LEAP-Seq n confirming:1475
LEAP-Seq n nonconfirming:2
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:GTGTGGTGTGTCGAGTACGG
Suggested primer 2:GCAACTGACAGTACAGCCCA