| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.201404 |
| Chromosome: | chromosome 10 |
| Location: | 830095 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g423500 | HMO1,HMOX1 | Heme oxygenase; (1 of 1) PTHR35703//PTHR35703:SF2 - FAMILY NOT NAMED // HEME OXYGENASE 4, CHLOROPLASTIC | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCTCGATCCACCGCCTCGGTCCGTGCC |
| Internal bar code: | CCGACTCGAGTGGAACGAGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 924 |
| LEAP-Seq percent confirming: | 99.8529 |
| LEAP-Seq n confirming: | 4072 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACGCTTAGTGCTGGTTCA |
| Suggested primer 2: | CTTCGACTCAACCAGGAAGC |