| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.201486 |
| Chromosome: | chromosome 9 |
| Location: | 4116715 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393654 | RLS11 | RegA/Rls-like protein; (1 of 10) IPR010919 - SAND domain-like | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGATGGGCTCGAGTAGCGGGCGGGCGC |
| Internal bar code: | CGATTTCCCTGTATGGGGTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 758 |
| LEAP-Seq percent confirming: | 61.8731 |
| LEAP-Seq n confirming: | 1394 |
| LEAP-Seq n nonconfirming: | 859 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCGCTGTACAATGAAACCT |
| Suggested primer 2: | TCCTCCTCCTCTTCCTCCTC |