Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.201580 |
Chromosome: | chromosome 1 |
Location: | 4558922 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g031050 | (1 of 1) K15172 - transcription elongation factor SPT5 (SUPT5H, SPT5) | 5'UTR|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATTCTGTGTGCCCTACCCCCATGCTAGC |
Internal bar code: | CAATCCCTATCCTAACGGGCAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 916 |
LEAP-Seq percent confirming: | 98.9311 |
LEAP-Seq n confirming: | 2499 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGGTCCATGATATCCCAAA |
Suggested primer 2: | TGCCAAGCTTACCTCGACTT |