| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.201635 |
| Chromosome: | chromosome 12 |
| Location: | 6485115 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g538400 | RPB4,RPB7B | (1 of 1) K03022 - DNA-directed RNA polymerase III subunit RPC8 (RPC8, POLR3H); DNA-directed RNA polymerase II, 19 kDa polypeptide | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACAGAACAGAGCTCGTCACACACATCAG |
| Internal bar code: | TCCAAGGCGTAAATCGACGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 799 |
| LEAP-Seq percent confirming: | 98.1721 |
| LEAP-Seq n confirming: | 2578 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGCCAGAACGCAGTAAAG |
| Suggested primer 2: | TCGAAGAAGTCCAGCGAGAT |