Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.201665 |
Chromosome: | chromosome 3 |
Location: | 8150196 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g200600 | KIN14A1,KIN14A-1,KIN14-4 | Kinesin motor protein; (1 of 2) K10405 - kinesin family member C1 (KIFC1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATACGGTACGGTACGAGGCATACAGCTCA |
Internal bar code: | TAGCAAGCGCTCAGAATATGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 734 |
LEAP-Seq percent confirming: | 99.6542 |
LEAP-Seq n confirming: | 9511 |
LEAP-Seq n nonconfirming: | 33 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTAGAGGAATTGCCCCACAC |
Suggested primer 2: | ACCTGTCCCTCTTGCTGCTA |