| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.201798 |
| Chromosome: | chromosome 17 |
| Location: | 5453308 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g737100 | FAP127 | (1 of 1) PTHR19265:SF0 - MEIOSIS-SPECIFIC NUCLEAR STRUCTURAL PROTEIN 1; Flagellar Associated Protein 127 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTGAGCGCAAGCGTGGCGGCCTGCTGGG |
| Internal bar code: | TCCTCGGTAAATTTGGAACGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 755 |
| LEAP-Seq percent confirming: | 99.6974 |
| LEAP-Seq n confirming: | 5272 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTGAGTGAGTGTGCGGTC |
| Suggested primer 2: | CTCTAGCTTGACCCCACGAG |