Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.201804 |
Chromosome: | chromosome 7 |
Location: | 6069387 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g355300 | BES5 | (1 of 10) PF01062 - Bestrophin, RFP-TM, chloride channel (Bestrophin); putative chloride channel | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCGGCCTGACGACCGTGTCTGACTGTGC |
Internal bar code: | TCTCCCGCTGGTGAGGAGCTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 699 |
LEAP-Seq percent confirming: | 99.4949 |
LEAP-Seq n confirming: | 197 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCCAGACCACAACTCACAA |
Suggested primer 2: | GCTGTAGCTCTCCATTTCCG |