| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.202019 |
| Chromosome: | chromosome 4 |
| Location: | 1997631 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g218750 | THB4 | Truncated hemoglobin; (1 of 1) IPR012292 - Globin/Protoglobin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGTGAGGGCTGCGTAAACGGTAAAGTTG |
| Internal bar code: | TCTATATGTGTCTGGTGGAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 990 |
| LEAP-Seq percent confirming: | 99.6162 |
| LEAP-Seq n confirming: | 2336 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGTTACCATGTCCACTCC |
| Suggested primer 2: | ATCACAAAGGTTTCAACGGC |