Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.202032 |
Chromosome: | chromosome 3 |
Location: | 751115 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g146207 | MPA1 | Metallophosphoesterase, phosphate-repressible; (1 of 1) PTHR32440//PTHR32440:SF0 - FAMILY NOT NAMED // PHOSPHATASE DCR2-RELATED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCGGCCGGCGGCCTTCTCCAGCGCCAT |
Internal bar code: | AAGGAGAACACGTTGCAACGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 614 |
LEAP-Seq percent confirming: | 99.8384 |
LEAP-Seq n confirming: | 3089 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTTCTGGTACAGGTCGAT |
Suggested primer 2: | CGTCTACGTGATGGATGGTG |